Vector pSB1AT3F / BBa_J18903

Specifications

  • Format:

    fusion

  • Markers:
  • Size (bp):

    3462

  • Users:

    raik

Actions

Edit

Delete

Description

3A construction plasmid BBFreiburg

pSB1AT3 is a high copy number plasmid carrying ampicillin and tetracycline resistance. The replication origin is a pUC19-derived pMB1 (copy number of 100-300 per cell).

The given sequence starts with the Freiburg BB suffix and ends with the Freiburg BB prefix. The complete vector sequence is obtained from: part + vector

This vector contains 3 point mutations in the Tc resistance gene in order to delete 3 NgoMIV sites.

Comments

not tested!

References

Sequence

Sequence should start with suffix and end with prefix
accggttaatactagtagcggccgctgcagtccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaa
accgaaaagattacttcgcgttatgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcgg
tatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggc
cagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaa
aaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcg
tgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcat
agctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcc
cgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca
ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacact
agaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaa
acaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatc
ctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaa
aggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagctcgagattctcatgtttgacagcttatcatcgataagctttaatgcggtagtttatcacagttaaattgctaacgc
agtcaggcaccgtgtatgaaatctaacaatgcgctcatcgtcatcctcggcaccgtcaccctggatgctgtaggcatagg
cttggttatgccggtactgccgggcctcttgcgggatatcgtccattccgacagcatcgccagtcactatggcgtgctgc
tagcgctatatgcgttgatgcaatttctatgcgcacccgttctcggagcactgtccgaccgctttggccgccgcccagtc
ctgctcgcttcgctacttggagccactatcgactacgcgatcatggcgaccacacccgtcctgtggatcctctacgccgg
acgcatcgtggccggtatcaccggcgccacaggtgcggttgctggcgcctatatcgccgacatcaccgatggggaagatc
gggctcgccacttcgggctcatgagcgcttgtttcggcgtgggtatggtggcaggccccgtggccgggggactgttgggc
gccatctccttgcatgcaccattccttgcggcggcggtgctcaacggcctcaacctactactgggctgcttcctaatgca
ggagtcgcataagggagagcgtcgaccgatgcccttgagagccttcaacccagtcagctccttccggtgggcgcggggca
tgactatcgtcgccgcacttatgactgtcttctttatcatgcaactcgtaggacaggttccggcagcgctctgggtcatt
ttcggcgaggaccgctttcgctggagcgcgacgatgatcggcctgtcgcttgcggtattcggaatcttgcacgccctcgc
tcaagccttcgtcactggtcccgccaccaaacgtttcggcgagaagcaggccattatcgcgggcatggcggccgacgcgc
tgggctacgtcttgctggcgttcgcgacgcgaggctggatggccttccccattatgattcttctcgcttccggcggcatc
gggatgcccgcgttgcaggccatgctgtccaggcaggtagatgacgaccatcagggacagcttcaaggatcgctcgcggc
tcttaccagcctaacttcgatcactggaccgctgatcgtcacggcgatttatgccgcctcggcgagcacatggaacgggt
tggcatggattgtaggcgccgccctataccttgtctgcctccccgcgttgcgtcgcggtgcatggagccgggccacctcg
acctaactcgagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcct
gactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagaccca
cgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatc
cgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttg
ccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcga
gttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgc
agtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactg
gtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataat
accgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttacc
gctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctg
ggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttc
ctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataa
acaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacct
ataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcg
cggccgcttctagatggccggc

Availability / Stock

This Vector can be found in the following Physical DNAs and Samples:

Samplewith Biobrickin Container StorageComment
rg01/08/08-77 rg0010 (ccdB) C_003 cells
rg07/08/08-3 rg0010 (ccdB) C_008 cells directly stocked from re-transformed ...
rg05/08/08-62 rg0010 (ccdB) D_CRG_001 dna labbook: 22/07/08-3b sequencing: rg2...
rg07/08/08-68 rg0010 (ccdB) D_CRG_001 dna directly stocked from re-transformed ...
rg11-A1 rg1005 (uraleft-LEU) D_011 dna eluted in H2O miniprep 05/01/09
rg11-B1 rg1005 (uraleft-LEU) D_011 dna eluted in H2O miniprep 05/01/09-1b
rg11-A2 rg1006 (uraleft-HIS) D_011 dna eluted in H2O miniprep 05/01/09-2a
rg11-B2 rg1006 (uraleft-HIS) D_011 dna eluted in H2O miniprep 05/01/09-2b
rg11-A3 rg1007 (hisleft-URA) D_011 dna eluted in H2O miniprep 05/01/09-3a
rg11-B3 rg1007 (hisleft-URA) D_011 dna eluted in H2O miniprep 05/01/09-3b
rg11-A4 rg1008 (hisleft-LEU) D_011 dna eluted in H2O miniprep 05/01/09-4a
rg11-B4 rg1008 (hisleft-LEU) D_011 dna eluted in H2O miniprep 05/01/09-4b
rg11-A5 rg1009 (trpleft-URA) D_011 dna eluted in H2O miniprep 05/01/09-5a
rg11-B5 rg1009 (trpleft-URA) D_011 dna eluted in H2O miniprep 05/01/09-5a
rg11-A6 rg1010 (trpleft-LEU) D_011 dna eluted in H2O miniprep 05/01/09-6a
rg11-B6 rg1010 (trpleft-LEU) D_011 dna eluted in H2O miniprep 05/01/09-6b
rg11-A7 rg1011 (leuleft-URA) D_011 dna eluted in H2O miniprep 05/01/09-7a
rg11-B7 rg1011 (leuleft-URA) D_011 dna eluted in H2O miniprep 05/01/09-7b
rg11-A8 rg1012 (leuleft-HIS) D_011 dna eluted in H2O miniprep 05/01/09-8a
rg11-B8 rg1012 (leuleft-HIS) D_011 dna eluted in H2O miniprep 05/01/09-8b
rg11-A9 rg1013 (KozakCitrine) D_011 dna eluted in H2O miniprep 17/02-9a
rg11-B9 rg1013 (KozakCitrine) D_011 dna * eluted in H2O * miniprep 17/02-9b ...
rg11-A10 rg1014 (KozakCherry) D_011 dna * eluted in H2O * miniprep 17/02-10a...
rg11-B10 rg1014 (KozakCherry) D_011 dna * eluted in H2O * miniprep 17/02-10b...
rg11-A11 rg1015 (KozakCerulean) D_011 dna * eluted in H2O * miniprep 17/02-11a...
rg11-B11 rg1015 (KozakCerulean) D_011 dna * eluted in H2O * miniprep 17/02-11b...
rg21-a1 rg1016 (hGLuc1-10aa) C_021 cells labbook 04/05/09 corresponds to rg11-c1
rg11-c1 rg1016 (hGLuc1-10aa) D_011 dna 100 ┬Ál + 28 (lower miniprep conc. tha...
rg21-a2 rg1017 (hGLuc2-10aa) C_021 cells labbook 04/05/09 corresponds to rg11-d2
rg11-c2 rg1017 (hGLuc2-10aa) D_011 dna
rg11-d2 rg1017 (hGLuc2-10aa) D_011 dna
rg21-a3 rg1018 (mCitrine-10aa) C_021 cells labbook 04/05/09 corresponds to rg11-c3
rg11-c3 rg1018 (mCitrine-10aa) D_011 dna
rg11-d3 rg1018 (mCitrine-10aa) D_011 dna
rg21-a4 rg1019 (mCerulean-10aa) C_021 cells labbook 04/05/09 corresponds to rg11-c4
rg11-c4 rg1019 (mCerulean-10aa) D_011 dna
rg21-a5 rg1020 (bLac1-10aa) C_021 cells labbook 04/05/09 corresponds to rg11-c5
rg11-c5 rg1020 (bLac1-10aa) D_011 dna
rg11-c6 rg1021 (bLac2-10aa) D_011 dna miniprep 04/03/09 (unlike others from...
rg11-d6 rg1021 (bLac2-10aa) D_011 dna miniprep 04/03/09 (unlike others from...
rg11-c7 rg1022 (StrepII-T7Stop) D_011 dna
rg11-c8 rg1023 (GST-T7Stop) D_011 dna
rg11-d8 rg1023 (GST-T7Stop) D_011 dna
rg21-a9 rg1024 (preGST-T7Stop) C_021 cells labbook 04/05/09 corresponds to rg11-c9
rg11-c9 rg1024 (preGST-T7Stop) D_011 dna
rg11-d9 rg1024 (preGST-T7Stop) D_011 dna
rg21-a10 rg1025 (preStrepII-T7Stop) C_021 cells labbook 04/05/09 corresponds to rg11...
rg11-c10 rg1025 (preStrepII-T7Stop) D_011 dna
rg21-b1 rg1026 (10aa-hGLuc1) C_021 cells labbook 04/05/09 corresponds to rg11-e1
rg11-e1 rg1026 (10aa-hGLuc1) D_011 dna miniprep 04/03/09
rg11-f1 rg1026 (10aa-hGLuc1) D_011 dna miniprep 04/03/09
rg21-b2 rg1027 (10aa-hGLuc2) C_021 cells labbook 04/05/09 corresponds to rg11-e3
rg11-e3 rg1027 (10aa-hGLuc2) D_011 dna miniprep 04/03/09
rg21-b3 rg1028 (10aa-mCitrine) C_021 cells labbook 04/05/09 corresponds to rg11-e4
rg11-e4 rg1028 (10aa-mCitrine) D_011 dna miniprep 04/03/09
rg11-f4 rg1028 (10aa-mCitrine) D_011 dna miniprep 04/03/09
rg21-b4 rg1029 (10aa-mCherry) C_021 cells labbook 04/05/09 corresponds to rg11-e5
rg11-e5 rg1029 (10aa-mCherry) D_011 dna miniprep 04/03/09
rg11-f5 rg1029 (10aa-mCherry) D_011 dna miniprep 04/03/09
rg21-b5 rg1030 (10aa-mCerulean) C_021 cells labbook 04/05/09 corresponds to rg11-e6
rg11-e6 rg1030 (10aa-mCerulean) D_011 dna miniprep 04/03/09
rg21-b6 rg1031 (10aa-bLac1) C_021 cells labbook 04/05/09 corresponds to rg11-e7
rg11-e7 rg1031 (10aa-bLac1) D_011 dna miniprep 04/03/09
rg11-e8 rg1032 (10aa-bLac2) D_011 dna miniprep 04/03/09
rg11-f8 rg1032 (10aa-bLac2) D_011 dna miniprep 04/03/09
rg21-b8 rg1033 (10aa-bLac1opt) C_021 cells labbook 04/05/09 corresponds to rg11-f9
rg11-e9 rg1033 (10aa-bLac1opt) D_011 dna miniprep 04/03/09
rg11-f9 rg1033 (10aa-bLac1opt) D_011 dna miniprep 04/03/09
rg21-b9 rg1034 (10aa-bLac2opt) C_021 cells labbook 04/05/09 corresponds to rg11...
rg11-e10 rg1034 (10aa-bLac2opt) D_011 dna miniprep 04/03/09
rg11-f10 rg1034 (10aa-bLac2opt) D_011 dna miniprep 04/03/09
rg10-55 rg1035 (T7-mCerulean) D_010 dna miniprep 04/03/09 together with minip...
rg10-56 rg1035 (T7-mCerulean) D_010 dna miniprep 04/03/09 together with minip...
rg19-a1 rg1078 (T7-FKBP~GLucA) C_019 cells glycerol stock from miniprep culture ...
rg19-b1 rg1078 (T7-FKBP~GLucA) C_019 cells glycerol stock from miniprep culture ...
rg20-a1 rg1078 (T7-FKBP~GLucA) D_020 dna ! low concentration robotic miniprep...
rg20-b1 rg1078 (T7-FKBP~GLucA) D_020 dna ! low concentration robotic miniprep...
rg19-a2 rg1079 (T7-FKBP~GLucB) C_019 cells glycerol stock from miniprep culture ...
rg19-b2 rg1079 (T7-FKBP~GLucB) C_019 cells glycerol stock from miniprep culture ...
rg20-a2 rg1079 (T7-FKBP~GLucB) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-b2 rg1079 (T7-FKBP~GLucB) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-a3 rg1080 (T7-FKBP~Citrine) C_019 cells glycerol stock from miniprep culture ...
rg19-b3 rg1080 (T7-FKBP~Citrine) C_019 cells glycerol stock from miniprep culture ...
rg20-a3 rg1080 (T7-FKBP~Citrine) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-b3 rg1080 (T7-FKBP~Citrine) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-a4 rg1081 (T7-FKBP~Cherry) C_019 cells glycerol stock from miniprep culture ...
rg19-b4 rg1081 (T7-FKBP~Cherry) C_019 cells glycerol stock from miniprep culture ...
rg20-a4 rg1081 (T7-FKBP~Cherry) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-b4 rg1081 (T7-FKBP~Cherry) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-a5 rg1082 (T7-FKBP~Cerulean) C_019 cells glycerol stock from miniprep culture ...
rg19-b5 rg1082 (T7-FKBP~Cerulean) C_019 cells glycerol stock from miniprep culture ...
rg20-a5 rg1082 (T7-FKBP~Cerulean) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-b5 rg1082 (T7-FKBP~Cerulean) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-a6 rg1083 (T7-FKBP~LacA) C_019 cells glycerol stock from miniprep culture ...
rg19-b6 rg1083 (T7-FKBP~LacA) C_019 cells glycerol stock from miniprep culture ...
rg20-a6 rg1083 (T7-FKBP~LacA) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-b6 rg1083 (T7-FKBP~LacA) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-a7 rg1084 (T7-FKBP~LacB) C_019 cells glycerol stock from miniprep culture ...
rg19-b7 rg1084 (T7-FKBP~LacB) C_019 cells glycerol stock from miniprep culture ...
rg20-a7 rg1084 (T7-FKBP~LacB) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-b7 rg1084 (T7-FKBP~LacB) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-a8 rg1085 (T7-FRB~GLucA) C_019 cells glycerol stock from miniprep culture ...
rg19-b8 rg1085 (T7-FRB~GLucA) C_019 cells glycerol stock from miniprep culture ...
rg20-a8 rg1085 (T7-FRB~GLucA) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-b8 rg1085 (T7-FRB~GLucA) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-a9 rg1086 (T7-FRB~GLucB) C_019 cells glycerol stock from miniprep culture ...
rg19-b9 rg1086 (T7-FRB~GLucB) C_019 cells glycerol stock from miniprep culture ...
rg20-a9 rg1086 (T7-FRB~GLucB) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-b9 rg1086 (T7-FRB~GLucB) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-a10 rg1087 (T7-FRB~Cherry) C_019 cells glycerol stock from miniprep culture ...
rg19-b10 rg1087 (T7-FRB~Cherry) C_019 cells glycerol stock from miniprep culture ...
rg20-a10 rg1087 (T7-FRB~Cherry) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-b10 rg1087 (T7-FRB~Cherry) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-e6 rg1088 (T7-FRB~Cerulean) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f6 rg1088 (T7-FRB~Cerulean) C_019 cells ass round 11, clone b cell stock 17/...
rg19-e7 rg1089 (T7-FRB~LacA) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f7 rg1089 (T7-FRB~LacA) C_019 cells ass round 11, clone b cell stock 17/...
rg19-a11 rg1090 (T7-FRB~LacB) C_019 cells glycerol stock from miniprep culture ...
rg19-b11 rg1090 (T7-FRB~LacB) C_019 cells glycerol stock from miniprep culture ...
rg20-a11 rg1090 (T7-FRB~LacB) D_020 dna ! lower concentration robotic minipr...
rg20-b11 rg1090 (T7-FRB~LacB) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-a12 rg1091 (T7-Zip1~GLucA) C_019 cells glycerol stock from miniprep culture ...
rg19-b12 rg1091 (T7-Zip1~GLucA) C_019 cells glycerol stock from miniprep culture ...
rg20-a12 rg1091 (T7-Zip1~GLucA) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-b12 rg1091 (T7-Zip1~GLucA) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-c1 rg1092 (>Zip1Cerul) C_019 cells
rg19-d1 rg1092 (>Zip1Cerul) C_019 cells
rg20-c1 rg1092 (>Zip1Cerul) D_020 dna
rg20-d1 rg1092 (>Zip1Cerul) D_020 dna
rg19-c2 rg1093 (T7-Zip1~Cherry) C_019 cells glycerol stock from miniprep culture ...
rg19-d2 rg1093 (T7-Zip1~Cherry) C_019 cells glycerol stock from miniprep culture ...
rg20-c2 rg1093 (T7-Zip1~Cherry) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-d2 rg1093 (T7-Zip1~Cherry) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-c3 rg1094 (T7-Zip2~GLucB) C_019 cells glycerol stock from miniprep culture ...
rg19-d3 rg1094 (T7-Zip2~GLucB) C_019 cells glycerol stock from miniprep culture ...
rg20-c3 rg1094 (T7-Zip2~GLucB) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-d3 rg1094 (T7-Zip2~GLucB) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-c5 rg1096 (T7-Zip1~LacA) C_019 cells glycerol stock from miniprep culture ...
rg19-d5 rg1096 (T7-Zip1~LacA) C_019 cells glycerol stock from miniprep culture ...
rg20-c5 rg1096 (T7-Zip1~LacA) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-d5 rg1096 (T7-Zip1~LacA) D_020 dna robotic miniprep 07/04/09 interaction...
none rg1097 none none none none
rg19-c6 rg1098 (T7-LOV2~GLucA) C_019 cells glycerol stock from miniprep culture ...
rg19-d6 rg1098 (T7-LOV2~GLucA) C_019 cells glycerol stock from miniprep culture ...
rg20-c6 rg1098 (T7-LOV2~GLucA) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-d6 rg1098 (T7-LOV2~GLucA) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-c7 rg1099 (T7-LOV2~GLucB) C_019 cells glycerol stock from miniprep culture ...
rg19-d7 rg1099 (T7-LOV2~GLucB) C_019 cells glycerol stock from miniprep culture ...
rg20-c7 rg1099 (T7-LOV2~GLucB) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-d7 rg1099 (T7-LOV2~GLucB) D_020 dna ! low concentration robotic miniprep...
rg19-c8 rg1100 (T7-LOV2~Citrine) C_019 cells ! not grown -- empty glycerol stock ...
rg19-d8 rg1100 (T7-LOV2~Citrine) C_019 cells glycerol stock from miniprep culture ...
rg20-c8 rg1100 (T7-LOV2~Citrine) D_020 dna ! not grown -- empty ! robotic minip...
rg20-d8 rg1100 (T7-LOV2~Citrine) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-c9 rg1101 (T7-LOV2~Cerulean) C_019 cells glycerol stock from miniprep culture ...
rg20-c9 rg1101 (T7-LOV2~Cerulean) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-c10 rg1102 (T7-GLucA~Lov2) C_019 cells glycerol stock from miniprep culture ...
rg19-d10 rg1102 (T7-GLucA~Lov2) C_019 cells glycerol stock from miniprep culture ...
rg20-c10 rg1102 (T7-GLucA~Lov2) D_020 dna ! low concentration robotic miniprep...
rg20-d10 rg1102 (T7-GLucA~Lov2) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-c11 rg1103 (T7-GLucB~Lov2) C_019 cells glycerol stock from miniprep culture ...
rg19-d11 rg1103 (T7-GLucB~Lov2) C_019 cells glycerol stock from miniprep culture ...
rg20-c11 rg1103 (T7-GLucB~Lov2) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-d11 rg1103 (T7-GLucB~Lov2) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-c12 rg1104 (T7-Citrine~Lov2) C_019 cells glycerol stock from miniprep culture ...
rg19-d12 rg1104 (T7-Citrine~Lov2) C_019 cells glycerol stock from miniprep culture ...
rg20-c12 rg1104 (T7-Citrine~Lov2) D_020 dna robotic miniprep 07/04/09 interaction...
rg20-d12 rg1104 (T7-Citrine~Lov2) D_020 dna robotic miniprep 07/04/09 interaction...
rg19-e9 rg1105 (T7-Cerulean~Lov2) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f9 rg1105 (T7-Cerulean~Lov2) C_019 cells ass round 11, clone b cell stock 17/...
rg22-a9 rg1105 (T7-Cerulean~Lov2) D_022 dna corresponds to rg19-e9 labbook 20/04/09
rg22-b9 rg1105 (T7-Cerulean~Lov2) D_022 dna corresponds to rg19-e9 labbook 20/04/09
rg22-c9 rg1105 (T7-Cerulean~Lov2) D_022 dna corresponds to rg19-f9 labbook 20/04/09
rg22-d9 rg1105 (T7-Cerulean~Lov2) D_022 dna corresponds to rg19-f9 labbook 20/04/09
rg08-10 rg1106 (preS-Hisx-T7Stop) C_008 cells 1 : 1 into 60 % Glycerol. Labbook 06...
rg08-11 rg1106 (preS-Hisx-T7Stop) C_008 cells 1 : 1 into 60 % Glycerol. Labbook 06...
rg08-08 rg1106 (preS-Hisx-T7Stop) C_008 cells 1 : 1 into 60 % Glycerol. Labbook 06...
rg08-09 rg1106 (preS-Hisx-T7Stop) C_008 cells 1 : 1 into 60 % Glycerol. Labbook 06...
rg19-e1 rg1106 (preS-Hisx-T7Stop) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f1 rg1106 (preS-Hisx-T7Stop) C_019 cells ass round 11, clone b cell stock 17/...
rg10-64 rg1106 (preS-Hisx-T7Stop) D_010 dna
rg10-68 rg1106 (preS-Hisx-T7Stop) D_010 dna manual miniprep 06/04/09 corresponds...
rg10-69 rg1106 (preS-Hisx-T7Stop) D_010 dna manual miniprep 06/04/09 corresponds...
rg10-70 rg1106 (preS-Hisx-T7Stop) D_010 dna manual miniprep 06/04/09 corresponds...
rg22-a1 rg1106 (preS-Hisx-T7Stop) D_022 dna corresponds to rg19-e... labbook 20/...
rg22-c1 rg1106 (preS-Hisx-T7Stop) D_022 dna corresponds to rg19-f... labbook 20/0...
rg19-e2 rg1107 (tev-HisX-T7<) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f2 rg1107 (tev-HisX-T7<) C_019 cells ass round 11, clone b cell stock 17/...
rg22-a2 rg1107 (tev-HisX-T7<) D_022 dna corresponds to rg19-e... labbook 20/...
rg22-c2 rg1107 (tev-HisX-T7<) D_022 dna corresponds to rg19-f... labbook 20/0...
rg19-e3 rg1108 (tev-HisX) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f3 rg1108 (tev-HisX) C_019 cells ass round 11, clone b cell stock 17/...
rg22-a3 rg1108 (tev-HisX) D_022 dna corresponds to rg19-e...
rg22-c3 rg1108 (tev-HisX) D_022 dna corresponds to rg19-f... labbook 20/0...
rg19-e4 rg1109 (preS-HisX) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f4 rg1109 (preS-HisX) C_019 cells ass round 11, clone a cell stock 17/...
rg22-a4 rg1109 (preS-HisX) D_022 dna suspicious colPCR corresponds to rg1...
rg22-c4 rg1109 (preS-HisX) D_022 dna corresponds to rg19-f... labbook 20/0...
rg19-e10 rg1111 (>T7-Zip1) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f10 rg1111 (>T7-Zip1) C_019 cells ass round 11, clone b cell stock 17/...
rg19-e11 rg1112 (>T7-Zip2) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f11 rg1112 (>T7-Zip2) C_019 cells ass round 11, clone a (like sample e1...
rg19-e8 rg1113 (T7~LacB) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f8 rg1113 (T7~LacB) C_019 cells ass round 11, clone b cell stock 17/...
rg10-67 None D_010 dna linear, digested, dephosphorylated ve...
rg10-27 None D_010 dna linear vector backbone from PCR with ...
rg10-03 None D_010 dna full plasmid miniprep 06/11/08 in H2O
rg10-49 None D_010 dna linear, digested vector backbone from...