Vector pSB1AK3F / BBa_J18902

Specifications

  • Format:

    fusion

  • Markers:
  • Size (bp):

    3205

  • Users:

    raik

Actions

Edit

Delete

Description

3A construction plasmid BBFreiburg

pSB1AK3 is a high copy number plasmid carrying ampicillin and kanamycin resistance. The replication origin is a pUC19-derived pMB1 (copy number of 100-300 per cell).

The given sequence starts with the Freiburg BB suffix and ends with the Freiburg BB prefix. The complete vector sequence is obtained from: part + vector

References

Sequence

Sequence should start with suffix and end with prefix
accggttaatactagtagcggccgctgcagtccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaa
accgaaaagattacttcgcgttatgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcgg
tatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggc
cagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaa
aaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcg
tgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcat
agctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcc
cgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca
ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacact
agaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaa
acaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatc
ctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaa
aggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagctcgagtcccgtcaagtcagcgtaatgctctgccagtgttacaaccaattaaccaattctgattagaaaaactcatc
gagcatcaaatgaaactgcaatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaag
gagaaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaata
caacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcaccatgagtgacgactgaatccggtgagaa
tggcaaaagcttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaa
ccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacagga
atcgaatgcaaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctg
gaatgctgttttcccggggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaa
gaggcataaattccgtcagccagtttagtctgaccatctcatctgtaacatcattggcaacgctacctttgccatgtttc
agaaacaactctggcgcatcgggcttcccatacaatcgatagattgtcgcacctgattgcccgacattatcgcgagccca
tttatacccatataaatcagcatccatgttggaatttaatcgcggcctggagcaagacgtttcccgttgaatatggctca
taacaccccttgtattactgtttatgtaagcagacagttttattgttcatgatgatatatttttatcttgtgcaatgtaa
catcagagattttgagacacaacgtggctttgttgaataaatcgaacttttgctgagttgaaggatcagctcgagttacc
aatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtag
ataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccaga
tttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtcta
ttaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatc
gtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccat
gttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatgg
ttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaag
tcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcag
aactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagtt
cgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacagga
aggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattg
aagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgc
gcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatc
acgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttctggaattcgcggccgcttctagatgg
ccggc

Availability / Stock

This Vector can be found in the following Physical DNAs and Samples:

Samplewith Biobrickin Container StorageComment
mc13-18 MC1018 C_013 cells
mc13-19 MC1019 C_013 cells
rg07/08/08-2 rg0010 (ccdB) C_008 cells directly stocked from re-transformed ...
rg12/08/08-01 rg0010 (ccdB) D_009 dna miniprep 10/07/08-11c from original I...
rg05/08/08-61 rg0010 (ccdB) D_CRG_001 dna labbook: 10/07/08-11b (miniprep from ...
rg07/08/08-67 rg0010 (ccdB) D_CRG_001 dna directly stocked from re-transformed ...
rg10-33 rg0013 (LEU2) D_010 dna Infusion 16/12/08; plate P 17/12/08-I...
rg10-34 rg0013 (LEU2) D_010 dna Infusion 16/12/08; plate P 17/12/08-I...
rg10-35 rg0014 (HIS3) D_010 dna Infusion 16/12/08; plate P 17/12/08-I...
rg23-e9 rg1077 (Zip2-aa-bLactB_opt) C_023 cells ass 11/05/09 iareadout 14-9a
rg23-f9 rg1077 (Zip2-aa-bLactB_opt) C_023 cells ass 11/05/09 iareadout 14-9b
rg24-e9 rg1077 (Zip2-aa-bLactB_opt) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-f9 rg1077 (Zip2-aa-bLactB_opt) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-h9 rg1077 (Zip2-aa-bLactB_opt) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg26-e9 rg1077 (Zip2-aa-bLactB_opt) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-f9 rg1077 (Zip2-aa-bLactB_opt) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg22-a6 rg1088 (T7-FRB~Cerulean) D_022 dna corresponds to rg19-e6 labbook 20/04/09
rg22-b6 rg1088 (T7-FRB~Cerulean) D_022 dna corresponds to rg19-e6 labbook 20/04/09
rg22-c6 rg1088 (T7-FRB~Cerulean) D_022 dna corresponds to rg19-f6 labbook 20/04/09
rg22-d6 rg1088 (T7-FRB~Cerulean) D_022 dna corresponds to rg19-f6 labbook 20/04/09
rg22-a7 rg1089 (T7-FRB~LacA) D_022 dna corresponds to rg19-e7 labbook 20/04/09
rg22-b7 rg1089 (T7-FRB~LacA) D_022 dna corresponds to rg19-e7 labbook 20/04/09
rg22-c7 rg1089 (T7-FRB~LacA) D_022 dna corresponds to rg19-f7 labbook 20/04/09
rg22-d7 rg1089 (T7-FRB~LacA) D_022 dna corresponds to rg19-f7 labbook 20/04/09
rg19-e5 rg1110 (>T7-FRB~Citrine) C_019 cells ass round 11, clone a cell stock 17/...
rg19-f5 rg1110 (>T7-FRB~Citrine) C_019 cells ass round 11, clone b cell stock 17/...
rg22-a5 rg1110 (>T7-FRB~Citrine) D_022 dna corresponds to rg19-e5 labbook 20/04/09
rg22-b5 rg1110 (>T7-FRB~Citrine) D_022 dna corresponds to rg19-e5 labbook 20/04/09
rg22-c5 rg1110 (>T7-FRB~Citrine) D_022 dna corresponds to rg19-f5 labbook 20/04/09
rg22-d5 rg1110 (>T7-FRB~Citrine) D_022 dna corresponds to rg19-f5 labbook 20/04/09
rg22-a10 rg1111 (>T7-Zip1) D_022 dna corresponds to rg19-e10 labbook 20/0...
rg22-b10 rg1111 (>T7-Zip1) D_022 dna corresponds to rg19-e10 labbook 20/0...
rg22-c10 rg1111 (>T7-Zip1) D_022 dna corresponds to rg19-f10 labbook 20/0...
rg22-d10 rg1111 (>T7-Zip1) D_022 dna corresponds to rg19-f10 labbook 20/0...
rg22-a11 rg1112 (>T7-Zip2) D_022 dna corresponds to rg19-e11 labbook 20/0...
rg22-b11 rg1112 (>T7-Zip2) D_022 dna corresponds to rg19-e11 labbook 20/0...
rg22-c11 rg1112 (>T7-Zip2) D_022 dna corresponds to rg19-f11 labbook 20/0...
rg22-d11 rg1112 (>T7-Zip2) D_022 dna corresponds to rg19-f11 labbook 20/0...
rg22-a8 rg1113 (T7~LacB) D_022 dna corresponds to rg19-e8 labbook 20/04/09
rg22-b8 rg1113 (T7~LacB) D_022 dna corresponds to rg19-e8 labbook 20/04/09
rg22-c8 rg1113 (T7~LacB) D_022 dna corresponds to rg19-f8 labbook 20/04/09
rg22-d8 rg1113 (T7~LacB) D_022 dna corresponds to rg19-f8 labbook 20/04/09
rg23-a1 rg1114 (>FKBPGLucApreHis<) C_023 cells ass 11/05/09 iareadout 12-1a
rg23-b1 rg1114 (>FKBPGLucApreHis<) C_023 cells ass 11/05/09 iareadout 12-1b
rg28-1a rg1114 (>FKBPGLucApreHis<) C_028 cells
rg28-1b rg1114 (>FKBPGLucApreHis<) C_028 cells
rg33-1c rg1114 (>FKBPGLucApreHis<) C_033 cells
rg33-1d rg1114 (>FKBPGLucApreHis<) C_033 cells
rg24-a1 rg1114 (>FKBPGLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-b1 rg1114 (>FKBPGLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g1 rg1114 (>FKBPGLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-6 rg1114 (>FKBPGLucApreHis<) D_025 dna manual mimi prep 16/06/09
rg26-a1 rg1114 (>FKBPGLucApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-b1 rg1114 (>FKBPGLucApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-a2 rg1115 (>FKBPGLucBpreHis<) C_023 cells ass 11/05/09 iareadout 12-2a
rg23-b2 rg1115 (>FKBPGLucBpreHis<) C_023 cells ass 11/05/09 iareadout 12-2b
rg28-2a rg1115 (>FKBPGLucBpreHis<) C_028 cells
rg28-2b rg1115 (>FKBPGLucBpreHis<) C_028 cells
rg33-2c rg1115 (>FKBPGLucBpreHis<) C_033 cells
rg33-2d rg1115 (>FKBPGLucBpreHis<) C_033 cells
rg24-a2 rg1115 (>FKBPGLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-b2 rg1115 (>FKBPGLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g2 rg1115 (>FKBPGLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-10 rg1115 (>FKBPGLucBpreHis<) D_025 dna manual mimi prep 07/07/09
rg26-a2 rg1115 (>FKBPGLucBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-b2 rg1115 (>FKBPGLucBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-a3 rg1116 (>FKBPCitrinepreHis<) C_023 cells ass 11/05/09 iareadout 12-3a
rg23-b3 rg1116 (>FKBPCitrinepreHis<) C_023 cells ass 11/05/09 iareadout 12-3b
rg28-3a rg1116 (>FKBPCitrinepreHis<) C_028 cells
rg28-3b rg1116 (>FKBPCitrinepreHis<) C_028 cells
rg24-a3 rg1116 (>FKBPCitrinepreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-b3 rg1116 (>FKBPCitrinepreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g3 rg1116 (>FKBPCitrinepreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-11 rg1116 (>FKBPCitrinepreHis<) D_025 dna manual mimi prep 07/07/09
rg25-2 rg1116 (>FKBPCitrinepreHis<) D_025 dna manual mimi prep 16/06/09 **could be...
rg26-a3 rg1116 (>FKBPCitrinepreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-b3 rg1116 (>FKBPCitrinepreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-a4 rg1117 (>FKBPCherrypreHis<) C_023 cells ass 11/05/09 iareadout 12-4a
rg28-4a rg1117 (>FKBPCherrypreHis<) C_028 cells
rg28-4b rg1117 (>FKBPCherrypreHis<) C_028 cells
rg33-4c rg1117 (>FKBPCherrypreHis<) C_033 cells
rg33-4d rg1117 (>FKBPCherrypreHis<) C_033 cells
rg24-a4 rg1117 (>FKBPCherrypreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g4 rg1117 (>FKBPCherrypreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-4 rg1117 (>FKBPCherrypreHis<) D_025 dna manual mimi prep 16/06/09
rg26-a4 rg1117 (>FKBPCherrypreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-a5 rg1118 (>FKBPCerulpreHis<) C_023 cells ass 11/05/09 iareadout 12-5a
rg23-b5 rg1118 (>FKBPCerulpreHis<) C_023 cells ass 11/05/09 iareadout 12-5b
rg28-5b rg1118 (>FKBPCerulpreHis<) C_028 cells
rg28-5a rg1118 (>FKBPCerulpreHis<) C_028 cells
rg24-a5 rg1118 (>FKBPCerulpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-b5 rg1118 (>FKBPCerulpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g5 rg1118 (>FKBPCerulpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-5 rg1118 (>FKBPCerulpreHis<) D_025 dna manual mimi prep 16/06/09
rg26-a5 rg1118 (>FKBPCerulpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-b5 rg1118 (>FKBPCerulpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-a6 rg1119 (>FKBPLacApreHis<) C_023 cells ass 11/05/09 iareadout 12-6a
rg23-b6 rg1119 (>FKBPLacApreHis<) C_023 cells ass 11/05/09 iareadout 12-6b
rg28-6a rg1119 (>FKBPLacApreHis<) C_028 cells
rg28-6b rg1119 (>FKBPLacApreHis<) C_028 cells
rg24-a6 rg1119 (>FKBPLacApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-b6 rg1119 (>FKBPLacApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g6 rg1119 (>FKBPLacApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-12 rg1119 (>FKBPLacApreHis<) D_025 dna manual mimi prep 07/07/09
rg26-a6 rg1119 (>FKBPLacApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-b6 rg1119 (>FKBPLacApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-a7 rg1120 (>FKBPLacBpreHis<) C_023 cells ass 11/05/09 iareadout 12-7a
rg23-b7 rg1120 (>FKBPLacBpreHis<) C_023 cells ass 11/05/09 iareadout 12-7b
rg28-7a rg1120 (>FKBPLacBpreHis<) C_028 cells
rg28-7b rg1120 (>FKBPLacBpreHis<) C_028 cells
rg24-a7 rg1120 (>FKBPLacBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-b7 rg1120 (>FKBPLacBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g7 rg1120 (>FKBPLacBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-8 rg1120 (>FKBPLacBpreHis<) D_025 dna manual mimi prep 16/06/09
rg26-a7 rg1120 (>FKBPLacBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-b7 rg1120 (>FKBPLacBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-a8 rg1121 (>FrbGLucApreHis<) C_023 cells ass 11/05/09 iareadout 12-8a
rg23-b8 rg1121 (>FrbGLucApreHis<) C_023 cells ass 11/05/09 iareadout 12-8b
rg28-8a rg1121 (>FrbGLucApreHis<) C_028 cells
rg28-8b rg1121 (>FrbGLucApreHis<) C_028 cells
rg33-8c rg1121 (>FrbGLucApreHis<) C_033 cells
rg33-8d rg1121 (>FrbGLucApreHis<) C_033 cells
rg24-a8 rg1121 (>FrbGLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-b8 rg1121 (>FrbGLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g8 rg1121 (>FrbGLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-1 rg1121 (>FrbGLucApreHis<) D_025 dna manual mimi prep 16/06/09 **could be...
rg25-13 rg1121 (>FrbGLucApreHis<) D_025 dna manual mimi prep 07/07/09
rg26-a8 rg1121 (>FrbGLucApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-b8 rg1121 (>FrbGLucApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-a9 rg1122 (>FrbGLucBpreHis<) C_023 cells ass 11/05/09 iareadout 12-9a
rg23-b9 rg1122 (>FrbGLucBpreHis<) C_023 cells ass 11/05/09 iareadout 12-9b
rg28-9a rg1122 (>FrbGLucBpreHis<) C_028 cells
rg28-9b rg1122 (>FrbGLucBpreHis<) C_028 cells
rg33-9d rg1122 (>FrbGLucBpreHis<) C_033 cells
rg33-9c rg1122 (>FrbGLucBpreHis<) C_033 cells
rg24-a9 rg1122 (>FrbGLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-b9 rg1122 (>FrbGLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g9 rg1122 (>FrbGLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-3 rg1122 (>FrbGLucBpreHis<) D_025 dna manual mimi prep 16/06/09
rg26-a9 rg1122 (>FrbGLucBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-b9 rg1122 (>FrbGLucBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-a10 rg1123 (>FrbCherrypreHis<) C_023 cells ass 11/05/09 iareadout 12-10a
rg23-b10 rg1123 (>FrbCherrypreHis<) C_023 cells ass 11/05/09 iareadout 12-10b
rg28-10a rg1123 (>FrbCherrypreHis<) C_028 cells
rg28-10b rg1123 (>FrbCherrypreHis<) C_028 cells
rg24-a10 rg1123 (>FrbCherrypreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-b10 rg1123 (>FrbCherrypreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g10 rg1123 (>FrbCherrypreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-7 rg1123 (>FrbCherrypreHis<) D_025 dna manual mimi prep 16/06/09
rg26-a10 rg1123 (>FrbCherrypreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-b10 rg1123 (>FrbCherrypreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-c1 rg1124 (>FrbLacBpreHis<) C_023 cells ass 11/05/09 iareadout 13-1a
rg23-d1 rg1124 (>FrbLacBpreHis<) C_023 cells ass 11/05/09 iareadout 13-1b
rg10-71 rg1124 (>FrbLacBpreHis<) D_010 dna manual mimiprep from cells grown on d...
rg24-a11 rg1124 (>FrbLacBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-c1 rg1124 (>FrbLacBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-d1 rg1124 (>FrbLacBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg26-c1 rg1124 (>FrbLacBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-d1 rg1124 (>FrbLacBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-c2 rg1125 (>Z1GLucApreHis<) C_023 cells ass 11/05/09 iareadout 13-2a
rg23-d2 rg1125 (>Z1GLucApreHis<) C_023 cells ass 11/05/09 iareadout 13-2b
rg28-11a rg1125 (>Z1GLucApreHis<) C_028 cells
rg28-11b rg1125 (>Z1GLucApreHis<) C_028 cells
rg33-11c rg1125 (>Z1GLucApreHis<) C_033 cells
rg33-11d rg1125 (>Z1GLucApreHis<) C_033 cells
rg10-72 rg1125 (>Z1GLucApreHis<) D_010 dna manual mimiprep from cells grown on d...
rg24-b11 rg1125 (>Z1GLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-c2 rg1125 (>Z1GLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-d2 rg1125 (>Z1GLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg26-c2 rg1125 (>Z1GLucApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-d2 rg1125 (>Z1GLucApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-c3 rg1126 (>Zip1CerulPreHis<) C_023 cells ass 11/05/09 iareadout 13-3a
rg23-d3 rg1126 (>Zip1CerulPreHis<) C_023 cells ass 11/05/09 iareadout 13-3b
rg28-12a rg1126 (>Zip1CerulPreHis<) C_028 cells
rg28-12b rg1126 (>Zip1CerulPreHis<) C_028 cells
rg33-12c rg1126 (>Zip1CerulPreHis<) C_033 cells
rg33-12d rg1126 (>Zip1CerulPreHis<) C_033 cells
rg10-73 rg1126 (>Zip1CerulPreHis<) D_010 dna ass 11/05/09 iareadout 13-3a manual ...
rg24-c11 rg1126 (>Zip1CerulPreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-c3 rg1126 (>Zip1CerulPreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-d3 rg1126 (>Zip1CerulPreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg25-14 rg1126 (>Zip1CerulPreHis<) D_025 dna manual mimi prep 07/07/09
rg26-c3 rg1126 (>Zip1CerulPreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-d3 rg1126 (>Zip1CerulPreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
none rg1127 none none none none
rg23-c5 rg1128 (>ZipRGLucBpreHis<) C_023 cells ass 11/05/09 iareadout 13-5a
rg23-d5 rg1128 (>ZipRGLucBpreHis<) C_023 cells ass 11/05/09 iareadout 13-5b
rg28-13a rg1128 (>ZipRGLucBpreHis<) C_028 cells
rg28-13b rg1128 (>ZipRGLucBpreHis<) C_028 cells
rg33-13c rg1128 (>ZipRGLucBpreHis<) C_033 cells
rg33-13d rg1128 (>ZipRGLucBpreHis<) C_033 cells
rg10-74 rg1128 (>ZipRGLucBpreHis<) D_010 dna ass 11/05/09 iareadout 13-5a manual ...
rg24-c5 rg1128 (>ZipRGLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-d11 rg1128 (>ZipRGLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-d5 rg1128 (>ZipRGLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg25-15 rg1128 (>ZipRGLucBpreHis<) D_025 dna manual mimi prep 07/07/09
rg26-c5 rg1128 (>ZipRGLucBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-d5 rg1128 (>ZipRGLucBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-c7 rg1130 (>ZELacApreHis<) C_023 cells ass 11/05/09 iareadout 13-7a
rg23-d7 rg1130 (>ZELacApreHis<) C_023 cells ass 11/05/09 iareadout 13-7b
rg28-14a rg1130 (>ZELacApreHis<) C_028 cells
rg28-14b rg1130 (>ZELacApreHis<) C_028 cells
rg10-75 rg1130 (>ZELacApreHis<) D_010 dna manual mimiprep from cells grown on d...
rg24-c7 rg1130 (>ZELacApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-d7 rg1130 (>ZELacApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-e11 rg1130 (>ZELacApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg26-c7 rg1130 (>ZELacApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-d7 rg1130 (>ZELacApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-c8 rg1131 (>Lov2GLucApreHis<) C_023 cells ass 11/05/09 iareadout 13-8a
rg23-d8 rg1131 (>Lov2GLucApreHis<) C_023 cells ass 11/05/09 iareadout 13-8b
rg28-15a rg1131 (>Lov2GLucApreHis<) C_028 cells
rg28-15b rg1131 (>Lov2GLucApreHis<) C_028 cells
rg33-15c rg1131 (>Lov2GLucApreHis<) C_033 cells
rg33-15d rg1131 (>Lov2GLucApreHis<) C_033 cells
rg10-76 rg1131 (>Lov2GLucApreHis<) D_010 dna manual mimiprep from cells grown on d...
rg24-c8 rg1131 (>Lov2GLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-d8 rg1131 (>Lov2GLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-f11 rg1131 (>Lov2GLucApreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg26-c8 rg1131 (>Lov2GLucApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-d8 rg1131 (>Lov2GLucApreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-c9 rg1132 (>Lov2GLucBpreHis<) C_023 cells ass 11/05/09 iareadout 13-9a
rg23-d9 rg1132 (>Lov2GLucBpreHis<) C_023 cells ass 11/05/09 iareadout 13-9b
rg28-16a rg1132 (>Lov2GLucBpreHis<) C_028 cells
rg28-16b rg1132 (>Lov2GLucBpreHis<) C_028 cells
rg33-16c rg1132 (>Lov2GLucBpreHis<) C_033 cells
rg33-16d rg1132 (>Lov2GLucBpreHis<) C_033 cells
rg10-77 rg1132 (>Lov2GLucBpreHis<) D_010 dna manual mimiprep from cells grown on d...
rg24-c9 rg1132 (>Lov2GLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-d9 rg1132 (>Lov2GLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-g11 rg1132 (>Lov2GLucBpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg26-c9 rg1132 (>Lov2GLucBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-d9 rg1132 (>Lov2GLucBpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-e1 rg1134 (>Lov2CerulpreHis<) C_023 cells ass 11/05/09 iareadout 14-1a
rg24-e1 rg1134 (>Lov2CerulpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-h1 rg1134 (>Lov2CerulpreHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg26-e1 rg1134 (>Lov2CerulpreHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-e2 rg1135 (>GLucALov2preHis<) C_023 cells ass 11/05/09 iareadout 14-2a
rg23-f2 rg1135 (>GLucALov2preHis<) C_023 cells ass 11/05/09 iareadout 14-2b
rg23-f3 rg1135 (>GLucALov2preHis<) C_023 cells error: supposed to be ass 11/05/09 ia...
rg28-17a rg1135 (>GLucALov2preHis<) C_028 cells
rg28-17b rg1135 (>GLucALov2preHis<) C_028 cells
rg33-17c rg1135 (>GLucALov2preHis<) C_033 cells
rg33-17d rg1135 (>GLucALov2preHis<) C_033 cells
rg24-e2 rg1135 (>GLucALov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-f2 rg1135 (>GLucALov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-h2 rg1135 (>GLucALov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-16 rg1135 (>GLucALov2preHis<) D_025 dna manual mimi prep 07/07/09
rg25-9 rg1135 (>GLucALov2preHis<) D_025 dna manual mimi prep 16/06/09
rg26-e2 rg1135 (>GLucALov2preHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-f2 rg1135 (>GLucALov2preHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-f3 rg1135 (>GLucALov2preHis<) D_026 dna robotic miniprep 11/06/09 error: supp...
rg23-e3 rg1136 (>GLucBLov2preHis<) C_023 cells ass 11/05/09 iareadout 14-3a probabl...
rg23-e5 rg1136 (>GLucBLov2preHis<) C_023 cells ass 11/05/09 iareadout 14-5a
rg23-f5 rg1136 (>GLucBLov2preHis<) C_023 cells ass 11/05/09 iareadout 14-5b
rg24-e3 rg1136 (>GLucBLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-e5 rg1136 (>GLucBLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-f3 rg1136 (>GLucBLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-f5 rg1136 (>GLucBLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-h3 rg1136 (>GLucBLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-h5 rg1136 (>GLucBLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg26-e3 rg1136 (>GLucBLov2preHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-e5 rg1136 (>GLucBLov2preHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-f5 rg1136 (>GLucBLov2preHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-e4 rg1137 (>CitrineLov2preHis<) C_023 cells ass 11/05/09 iareadout 14-4a
rg23-e6 rg1137 (>CitrineLov2preHis<) C_023 cells ass 11/05/09 iareadout 14-6a
rg23-f4 rg1137 (>CitrineLov2preHis<) C_023 cells ass 11/05/09 iareadout 14-4b
rg23-f6 rg1137 (>CitrineLov2preHis<) C_023 cells ass 11/05/09 iareadout 14-6b
rg28-18a rg1137 (>CitrineLov2preHis<) C_028 cells
rg28-18b rg1137 (>CitrineLov2preHis<) C_028 cells
rg33-18c rg1137 (>CitrineLov2preHis<) C_033 cells
rg33-18d rg1137 (>CitrineLov2preHis<) C_033 cells
rg24-e4 rg1137 (>CitrineLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-e6 rg1137 (>CitrineLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-f4 rg1137 (>CitrineLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-f6 rg1137 (>CitrineLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-h4 rg1137 (>CitrineLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-h6 rg1137 (>CitrineLov2preHis<) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg25-17 rg1137 (>CitrineLov2preHis<) D_025 dna manual mimi prep 07/07/09
rg26-e4 rg1137 (>CitrineLov2preHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-e6 rg1137 (>CitrineLov2preHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-f4 rg1137 (>CitrineLov2preHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-f6 rg1137 (>CitrineLov2preHis<) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-e10 rg1138 (>ZR34LacA) C_023 cells ass 11/05/09 iareadout 14-10a
rg24-e10 rg1138 (>ZR34LacA) D_024 dna robotic miniprep 19/05/09 ass 11/05/0...
rg24-h10 rg1138 (>ZR34LacA) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg26-e10 rg1138 (>ZR34LacA) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg23-e7 rg1139 (>ZE34~Lac2) C_023 cells ass 11/05/09 iareadout 14-7a
rg23-f7 rg1139 (>ZE34~Lac2) C_023 cells ass 11/05/09 iareadout 14-7b
rg24-e7 rg1139 (>ZE34~Lac2) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-f7 rg1139 (>ZE34~Lac2) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg24-h7 rg1139 (>ZE34~Lac2) D_024 dna robotic miniprep 19/05/09 ass 11/05/...
rg26-e7 rg1139 (>ZE34~Lac2) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg26-f7 rg1139 (>ZE34~Lac2) D_026 dna robotic miniprep 11/06/09 ass 11/05/0...
rg27-c07 rg1144 (Lov2CerulPreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-d07 rg1144 (Lov2CerulPreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg22-g07 rg1144 (Lov2CerulPreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-h07 rg1144 (Lov2CerulPreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg27-c08 rg1145 (GLucBLov2PreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-d08 rg1145 (GLucBLov2PreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg22-g08 rg1145 (GLucBLov2PreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-h08 rg1145 (GLucBLov2PreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg27-c10 rg1146 (>FKBPPreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-d10 rg1146 (>FKBPPreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg22-g10 rg1146 (>FKBPPreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-h10 rg1146 (>FKBPPreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg10-66 None D_010 dna linear, digested, dephosphorylated ve...
rg10-2 None D_010 dna full plasmid miniprep 06/11/08 in H2O
rg10-26 None D_010 dna linear vector backbone from PCR with ...
rg10-48 None D_010 dna linear, digested vector backbone from...