Vector pSB1AC3F / BBa_J18901

Specifications

  • Format:

    fusion

  • Markers:
  • Size (bp):

    3071

  • Users:

    raik

Actions

Edit

Delete

Description

3A construction plasmid BBFreiburg

pSB1AC3 is a high copy number plasmid carrying ampicillin and chloramphenicol resistance. The replication origin is a pUC19-derived pMB1 (copy number of 100-300 per cell). For the version of this plasmid with a CcdB insert, see BBa_P1010.

The given sequence starts with the Freiburg BB suffix and ends with the Freiburg BB prefix. The complete vector sequence is obtained from: part + vector

References

Sequence

Sequence should start with suffix and end with prefix
accggttaatactagtagcggccgctgcagtccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaa
accgaaaagattacttcgcgttatgcaggcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcgg
tatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggc
cagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaa
aaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcg
tgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcat
agctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcc
cgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca
ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacact
agaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaa
acaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatc
ctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaa
aggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctga
cagctcgaggcttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggagttctg
aggtcattactggatctatcaacaggagtccaagcgagctcgatatcaaattacgccccgccctgccactcatcgcagta
ctgttgtaattcattaagcattctgccgacatggaagccatcacaaacggcatgatgaacctgaatcgccagcggcatca
gcaccttgtcgccttgcgtataatatttgcccatggtgaaaacgggggcgaagaagttgtccatattggccacgtttaaa
tcaaaactggtgaaactcacccagggattggctgagacgaaaaacatattctcaataaaccctttagggaaataggccag
gttttcaccgtaacacgccacatcttgcgaatatatgtgtagaaactgccggaaatcgtcgtggtattcactccagagcg
atgaaaacgtttcagtttgctcatggaaaacggtgtaacaagggtgaacactatcccatatcaccagctcaccgtctttc
attgccatacgaaattccggatgagcattcatcaggcgggcaagaatgtgaataaaggccggataaaacttgtgcttatt
tttctttacggtctttaaaaaggccgtaatatccagctgaacggtctggttataggtacattgagcaactgactgaaatg
cctcaaaatgttctttacgatgccattgggatatatcaacggtggtatatccagtgatttttttctccattttagcttcc
ttagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctct
tacgtgcccgatcaactcgagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatcca
tagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccg
cgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgc
aactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgca
acgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacga
tcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaa
gttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgctttt
ctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaata
cgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaag
gatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcacca
gcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactc
atactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtattta
gaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatga
cattaacctataaaaataggcgtatcacgaggcagaatttcagataaaaaaaatccttagctttcgctaaggatgatttc
tggaattcgcggccgcttctagatggccggc

Availability / Stock

This Vector can be found in the following Physical DNAs and Samples:

Samplewith Biobrickin Container StorageComment
rg17/10/08-29 BBa_I757011 (bla_frag1) D_009 dna labbook 07/10/08-5b sequencing 0710-5b
rg10-51 BBa_I757011 (bla_frag1) D_010 dna labbook 26/02/09 clone A from re-tra...
rg10-52 BBa_I757011 (bla_frag1) D_010 dna labbook 26/02/09 clone 2 from re-tra...
rg17/10/08-30 BBa_I757012 (bla_frag2) D_009 dna labbook 07/10/08-6c sequencing 0710-6c
rg10-53 BBa_I757012 (bla_frag2) D_010 dna labbook 26/02/09 clone 1 from re-tra...
rg10-54 BBa_I757012 (bla_frag2) D_010 dna labbook 26/02/09 clone 2 from re-tra...
rg01/08/08-68 rg0001 (ura3-left) C_003 cells
rg10-36 rg0001 (ura3-left) D_010 dna miniprep 27/01/09-1
rg07/08/08-72 rg0001 (ura3-left) D_CRG_001 dna only about 10 ul left
rg01/08/08-69 rg0002 (ura3-right) C_003 cells
rg10-37 rg0002 (ura3-right) D_010 dna miniprep 27/01/09-2
rg07/08/08-73 rg0002 (ura3-right) D_CRG_001 dna only about 10 ul left
rg01/08/08-70 rg0003 C_003 cells
rg10-38 rg0003 D_010 dna miniprep 27/01/09-3
rg07/08/08-74 rg0003 D_CRG_001 dna only about 10 ul left
rg01/08/08-71 rg0004 (his3-right) C_003 cells
rg10-39 rg0004 (his3-right) D_010 dna miniprep 27/01/09-4
rg07/08/08-75 rg0004 (his3-right) D_CRG_001 dna only about 10 ul left
rg01/08/08-72 rg0005 C_003 cells
rg10-40 rg0005 D_010 dna miniprep 27/01/09-5
rg07/08/08-76 rg0005 D_CRG_001 dna 50 ul miniprep
rg01/08/08-73 rg0006 (trp1-right) C_003 cells
rg10-41 rg0006 (trp1-right) D_010 dna miniprep 27/01/09-6
rg07/08/08-77 rg0006 (trp1-right) D_CRG_001 dna 50 ul miniprep
rg01/08/08-74 rg0007 C_003 cells
rg10-42 rg0007 D_010 dna miniprep 27/01/09-7
rg07/08/08-78 rg0007 D_CRG_001 dna 50 ul miniprep
rg01/08/08-75 rg0008 (leu2-right) C_003 cells
rg10-43 rg0008 (leu2-right) D_010 dna miniprep 27/01/09-8
rg07/08/08-79 rg0008 (leu2-right) D_CRG_001 dna 50 ul miniprep
rg01/08/08-76 rg0010 (ccdB) C_003 cells
rg07/08/08-1 rg0010 (ccdB) C_008 cells directly stocked from re-transformed ...
rg05/08/08-60 rg0010 (ccdB) D_CRG_001 dna labbook: 10/07/08-10b (miniprep from ...
rg07/08/08-66 rg0010 (ccdB) D_CRG_001 dna derived from 10/07/08-10b; miniprep o...
rg10-32 rg0012 (URA3) D_010 dna Infusion 28/11/08; Plate P28/11-1b m...
rg17-c5 rg0021 (3xFLAG) C_017 cells subcloning ass 03/03/09. clone a'
rg17-c6 rg0021 (3xFLAG) C_017 cells subcloning ass 03/03/09. clone c`
rg18-c5 rg0021 (3xFLAG) D_018 dna robotic miniprep 17/03/09 subcloning ...
rg18-c6 rg0021 (3xFLAG) D_018 dna almost empty robotic miniprep 17/03/...
rg17-a1 rg0022 (His6) C_017 cells sample was missing from database
rg17-a2 rg0023 (StrepII) C_017 cells subcloning ass 03/03/09. clone a
rg18-a2 rg0023 (StrepII) D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-c7 rg0025 (TEVsite) C_017 cells subcloning ass 03/03/09. clone a`
rg17-c8 rg0025 (TEVsite) C_017 cells subcloning ass 03/03/09. clone b`
rg10-60 rg0025 (TEVsite) D_010 dna subcloning ass 03/03/09. clone b` **...
rg17-a3 rg0027 (T7start) C_017 cells subcloning ass 03/03/09. clone d
rg10-57 rg0027 (T7start) D_010 dna almost empty; subcloning ass 03/03/09...
rg10-63 rg0027 (T7start) D_010 dna subcloning ass 03/03/09. clone d **2...
rg18-a3 rg0027 (T7start) D_018 dna almost empty robotic miniprep 17/03/...
rg17-a4 rg0028 (T7stop) C_017 cells subcloning ass 03/03/09. clone a
rg17-a5 rg0028 (T7stop) C_017 cells subcloning ass 03/03/09. clone b
rg18-a4 rg0028 (T7stop) D_018 dna robotic miniprep 17/03/09 subcloning ...
rg18-a5 rg0028 (T7stop) D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-a6 rg0029 (GST) C_017 cells subcloning ass 03/03/09. clone a
rg17-a7 rg0029 (GST) C_017 cells subcloning ass 03/03/09. clone b
rg18-a6 rg0029 (GST) D_018 dna robotic miniprep 17/03/09 subcloning ...
rg18-a7 rg0029 (GST) D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-b2 rg0100 C_017 cells subcloning ass 03/03/09. clone a
rg17-b3 rg0100 C_017 cells subcloning ass 03/03/09. clone b
rg18-b2 rg0100 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg18-b3 rg0100 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-a8 rg0101 C_017 cells subcloning ass 03/03/09. clone d
rg18-a8 rg0101 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-b4 rg0102 C_017 cells subcloning ass 03/03/09. clone c
rg18-b4 rg0102 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-b5 rg0103 C_017 cells subcloning ass 03/03/09. clone b
rg18-b5 rg0103 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-b7 rg0105 C_017 cells subcloning ass 03/03/09. clone a
rg18-b6 rg0105 D_018 dna robotic miniprep 17/03/09 subcloning...
rg17-b6 rg0106 C_017 cells subcloning ass 03/03/09. clone b
rg17-b8 rg0106 C_017 cells subcloning ass 03/03/09. clone d
rg18-b7 rg0106 D_018 dna robotic miniprep 17/03/09 subcloning...
rg18-b8 rg0106 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-b10 rg0107 C_017 cells subcloning ass 03/03/09. clone b
rg17-b9 rg0107 C_017 cells subcloning ass 03/03/09. clone a
rg10-59 rg0107 D_010 dna subcloning ass 03/03/09. clone b **2...
rg18-b10 rg0107 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-b11 rg0108 C_017 cells subcloning ass 03/03/09. clone b
rg18-b11 rg0108 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-b12 rg0109 (ZipE34) C_017 cells subcloning ass 03/03/09. clone a
rg17-c1 rg0109 (ZipE34) C_017 cells subcloning ass 03/03/09. clone c
rg18-b12 rg0109 (ZipE34) D_018 dna robotic miniprep 17/03/09 subcloning ...
rg18-c1 rg0109 (ZipE34) D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-c2 rg0110 C_017 cells subcloning ass 03/03/09. clone b
rg18-c2 rg0110 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-c3 rg0111 C_017 cells subcloning ass 03/03/09. clone c
rg18-c3 rg0111 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-c4 rg0112 (ZipR34) C_017 cells subcloning ass 03/03/09. clone b
rg18-c4 rg0112 (ZipR34) D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-c9 rg0120 C_017 cells subcloning ass 03/03/09. clone a
rg17-a10 rg0122 (3xGS) C_017 cells subcloning ass 03/03/09. clone d
rg17-a9 rg0122 (3xGS) C_017 cells subcloning ass 03/03/09. clone c
rg10-61 rg0122 (3xGS) D_010 dna subcloning ass 03/03/09. clone c **2...
rg18-a10 rg0122 (3xGS) D_018 dna robotic miniprep 17/03/09 subcloning ...
rg18-a9 rg0122 (3xGS) D_018 dna robotic miniprep 17/03/09 subcloning...
rg17-c10 rg0124 (1xGS) C_017 cells subcloning ass 03/03/09. clone b
rg18-c8 rg0124 (1xGS) D_018 dna robotic miniprep 17/03/09 subcloning...
rg17-c11 rg0125 C_017 cells subcloning ass 03/03/09. clone a
rg17-c12 rg0125 C_017 cells subcloning ass 03/03/09. clone c
rg18-c10 rg0125 D_018 dna almost empty robotic miniprep 17/03/...
rg18-c9 rg0125 D_018 dna robotic miniprep 17/03/09 subcloning...
rg17-a11 rg0126 C_017 cells subcloning ass 03/03/09
rg10-58 rg0126 D_010 dna subcloning ass 03/03/09 **26/03/09 m...
rg17-d1 rg0127 C_017 cells subcloning ass 03/03/09. clone a
rg18-c11 rg0127 D_018 dna robotic miniprep 17/03/09 subcloning...
rg17-a12 rg0150 C_017 cells subcloning ass 03/03/09. clone a
rg17-b1 rg0150 C_017 cells subcloning ass 03/03/09. clone b
rg18-a12 rg0150 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg18-b1 rg0150 D_018 dna robotic miniprep 17/03/09 subcloning ...
rg17-d2 rg0152 C_017 cells subcloning ass 03/03/09. clone b
rg10-62 rg0152 D_010 dna subcloning ass 03/03/09. clone b **2...
rg18-c12 rg0152 D_018 dna almost empty robotic miniprep 17/03/...
rg10-23 rg1001 D_010 dna miniprep from first assembly. corres...
rg10-24 rg1002 D_010 dna miniprep from first assembly. corres...
rg10-29 rg1002 D_010 dna miniprep 19/11/08-3b assembly 10-11-...
rg10-28 rg1003 (His-T7Stop) D_010 dna *failed in several assemblies* minip...
rg10-30 rg1003 (His-T7Stop) D_010 dna almost empty 03/05/2010 miniprep 19/...
rg10-31 rg1004 D_010 dna miniprep 19/11/08-2a assembly 10-11-...
rg15-a1 rg1036 (FKBP-aahGLuc1) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-a2 rg1036 (FKBP-aahGLuc1) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-a1 rg1036 (FKBP-aahGLuc1) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-a2 rg1036 (FKBP-aahGLuc1) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-a3 rg1037 (FKBP-aahGLuc2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-a4 rg1037 (FKBP-aahGLuc2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-a3 rg1037 (FKBP-aahGLuc2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-a4 rg1037 (FKBP-aahGLuc2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-a5 rg1038 (FKBP-aamCitrine) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-a6 rg1038 (FKBP-aamCitrine) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-a5 rg1038 (FKBP-aamCitrine) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-a6 rg1038 (FKBP-aamCitrine) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-a7 rg1039 (FKBP-aamCherry) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-a8 rg1039 (FKBP-aamCherry) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-a7 rg1039 (FKBP-aamCherry) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-a8 rg1039 (FKBP-aamCherry) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-a10 rg1040 (FKBP-aamCerulean) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-a9 rg1040 (FKBP-aamCerulean) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-a10 rg1040 (FKBP-aamCerulean) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-a9 rg1040 (FKBP-aamCerulean) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-a11 rg1041 (FKBP-aabLacA) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-a11 rg1041 (FKBP-aabLacA) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-e4 rg1043 (FKBP-aabLacAopt) C_015 cells celan-up assembly, 18/03/09 clone b
rg15-f4 rg1043 (FKBP-aabLacAopt) C_015 cells celan-up assembly, 18/03/09 clone c
rg16-e4 rg1043 (FKBP-aabLacAopt) D_016 dna celan-up assembly, 18/03/09 clone b
rg16-f4 rg1043 (FKBP-aabLacAopt) D_016 dna celan-up assembly, 18/03/09 clone c
rg15-a12 rg1044 (FKBP-aabLacBopt) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-a12 rg1044 (FKBP-aabLacBopt) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-b1 rg1045 (FRB-aahGLuc1) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-b2 rg1045 (FRB-aahGLuc1) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-b1 rg1045 (FRB-aahGLuc1) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-b2 rg1045 (FRB-aahGLuc1) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-b3 rg1046 (FRB-aahGLuc2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-b4 rg1046 (FRB-aahGLuc2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-b3 rg1046 (FRB-aahGLuc2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-b4 rg1046 (FRB-aahGLuc2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-b5 rg1048 (FRB-aamCherry) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-b5 rg1048 (FRB-aamCherry) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-b6 rg1049 (FRB-aamCerulean) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-b7 rg1049 (FRB-aamCerulean) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-b6 rg1049 (FRB-aamCerulean) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-b7 rg1049 (FRB-aamCerulean) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-b8 rg1050 (FRB-aabLacA) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-b9 rg1050 (FRB-aabLacA) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-b8 rg1050 (FRB-aabLacA) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-b9 rg1050 (FRB-aabLacA) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-e5 rg1052 (FRB-aabLacAopt) C_015 cells celan-up assembly, 18/03/09 clone a
rg15-f5 rg1052 (FRB-aabLacAopt) C_015 cells celan-up assembly, 18/03/09 clone b'
rg16-e5 rg1052 (FRB-aabLacAopt) D_016 dna celan-up assembly, 18/03/09 clone a
rg16-f5 rg1052 (FRB-aabLacAopt) D_016 dna celan-up assembly, 18/03/09 clone b'
rg15-b10 rg1053 (FRB-aabLacBopt) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-b11 rg1053 (FRB-aabLacBopt) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-b10 rg1053 (FRB-aabLacBopt) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-b11 rg1053 (FRB-aabLacBopt) D_016 dna sample looks degraded on test digest ...
rg15-c1 rg1054 (Zip1-aahGluc1) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-c1 rg1054 (Zip1-aahGluc1) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-c2 rg1055 (Zip1-aaLacA) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-c2 rg1055 (Zip1-aaLacA) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-c3 rg1056 (Zip1-aamCerulean) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-c4 rg1056 (Zip1-aamCerulean) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-c3 rg1056 (Zip1-aamCerulean) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-c4 rg1056 (Zip1-aamCerulean) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-c5 rg1057 (Zip1-aamCherry) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-c5 rg1057 (Zip1-aamCherry) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-c6 rg1058 (Zip1-aahGLuc2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-c6 rg1058 (Zip1-aahGLuc2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-c7 rg1059 (ZipR34-aamCitrine) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-c7 rg1059 (ZipR34-aamCitrine) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-c8 rg1061 (LOV2-aahGLuc1) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-c9 rg1061 (LOV2-aahGLuc1) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-c8 rg1061 (LOV2-aahGLuc1) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-c9 rg1061 (LOV2-aahGLuc1) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-c10 rg1062 (LOV2-aahGLuc2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-c11 rg1062 (LOV2-aahGLuc2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-c10 rg1062 (LOV2-aahGLuc2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-c11 rg1062 (LOV2-aahGLuc2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-e8 rg1063 (LOV2-aamCitrine) C_015 cells celan-up assembly, 18/03/09 clone a
rg15-f8 rg1063 (LOV2-aamCitrine) C_015 cells celan-up assembly, 18/03/09 clone b
rg16-e8 rg1063 (LOV2-aamCitrine) D_016 dna celan-up assembly, 18/03/09 clone a
rg16-f8 rg1063 (LOV2-aamCitrine) D_016 dna celan-up assembly, 18/03/09 clone b
rg15-d1 rg1064 (LOV2-aamCerulean) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-d2 rg1064 (LOV2-aamCerulean) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-d1 rg1064 (LOV2-aamCerulean) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-d2 rg1064 (LOV2-aamCerulean) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-d3 rg1065 (LOV2-aabLacA) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-d3 rg1065 (LOV2-aabLacA) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-d4 rg1067 (hGLuc1-aaLOV2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-d5 rg1067 (hGLuc1-aaLOV2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-d4 rg1067 (hGLuc1-aaLOV2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-d5 rg1067 (hGLuc1-aaLOV2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-e9 rg1068 (hGLuc2-aaLOV2) C_015 cells celan-up assembly, 18/03/09 clone b
rg15-f9 rg1068 (hGLuc2-aaLOV2) C_015 cells celan-up assembly, 18/03/09 clone c
rg16-e9 rg1068 (hGLuc2-aaLOV2) D_016 dna celan-up assembly, 18/03/09 clone b
rg16-f9 rg1068 (hGLuc2-aaLOV2) D_016 dna celan-up assembly, 18/03/09 clone c
rg15-d6 rg1069 (mCitrine-aaLOV2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-d7 rg1069 (mCitrine-aaLOV2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-e10 rg1069 (mCitrine-aaLOV2) C_015 cells celan-up assembly, 18/03/09 clone b
rg15-f10 rg1069 (mCitrine-aaLOV2) C_015 cells celan-up assembly, 18/03/09 clone c
rg16-d6 rg1069 (mCitrine-aaLOV2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-d7 rg1069 (mCitrine-aaLOV2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-e10 rg1069 (mCitrine-aaLOV2) D_016 dna celan-up assembly, 18/03/09 clone b *...
rg16-f10 rg1069 (mCitrine-aaLOV2) D_016 dna celan-up assembly, 18/03/09 clone c
rg15-d8 rg1070 (mCerulean-aaLOV2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-d9 rg1070 (mCerulean-aaLOV2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-d8 rg1070 (mCerulean-aaLOV2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-d9 rg1070 (mCerulean-aaLOV2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-d10 rg1071 (bLacA-aaLOV2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg15-d11 rg1071 (bLacA-aaLOV2) C_015 cells 100 ul 60% Glycerol + 100 ul overnigh...
rg16-d10 rg1071 (bLacA-aaLOV2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg16-d11 rg1071 (bLacA-aaLOV2) D_016 dna millipore miniprep 12/03/09; eluted i...
rg15-e1 rg1073 (T7Start-FKBP) C_015 cells clean-up assembly 18/03/09 clone b'
rg15-f1 rg1073 (T7Start-FKBP) C_015 cells celan-up assembly, 18/03/09 clone c'
rg16-e1 rg1073 (T7Start-FKBP) D_016 dna clean-up assembly 18/03/09 clone b'
rg16-f1 rg1073 (T7Start-FKBP) D_016 dna celan-up assembly, 18/03/09 clone c' ...
rg15-e2 rg1074 (T7Start-FRB) C_015 cells celan-up assembly, 18/03/09 clone e
rg15-f2 rg1074 (T7Start-FRB) C_015 cells celan-up assembly, 18/03/09 clone d'
rg16-e2 rg1074 (T7Start-FRB) D_016 dna celan-up assembly, 18/03/09 clone e
rg16-f2 rg1074 (T7Start-FRB) D_016 dna celan-up assembly, 18/03/09 clone d'
rg15-e3 rg1075 (T7Start-LOV2) C_015 cells celan-up assembly, 18/03/09 clone b
rg16-e3 rg1075 (T7Start-LOV2) D_016 dna celan-up assembly, 18/03/09 clone b
rg15-e6 rg1076 (Zip1-aa-bLactA_opt) C_015 cells celan-up assembly, 18/03/09 clone c
rg15-f6 rg1076 (Zip1-aa-bLactA_opt) C_015 cells celan-up assembly, 18/03/09 clone c'
rg16-e6 rg1076 (Zip1-aa-bLactA_opt) D_016 dna celan-up assembly, 18/03/09 clone c
rg16-f6 rg1076 (Zip1-aa-bLactA_opt) D_016 dna celan-up assembly, 18/03/09 clone c'
rg15-e7 rg1077 (Zip2-aa-bLactB_opt) C_015 cells celan-up assembly, 18/03/09 clone a
rg15-f7 rg1077 (Zip2-aa-bLactB_opt) C_015 cells celan-up assembly, 18/03/09 clone a'
rg16-e7 rg1077 (Zip2-aa-bLactB_opt) D_016 dna celan-up assembly, 18/03/09 clone a
rg16-f7 rg1077 (Zip2-aa-bLactB_opt) D_016 dna celan-up assembly, 18/03/09 clone a'
rg27-a06 rg1127 (>ZipECherrypreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-a07 rg1127 (>ZipECherrypreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-b06 rg1127 (>ZipECherrypreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-b07 rg1127 (>ZipECherrypreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg28-21a rg1127 (>ZipECherrypreHis<) C_028 cells
rg28-21b rg1127 (>ZipECherrypreHis<) C_028 cells
rg22-e06 rg1127 (>ZipECherrypreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-e07 rg1127 (>ZipECherrypreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-f06 rg1127 (>ZipECherrypreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-f07 rg1127 (>ZipECherrypreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg25-20 rg1127 (>ZipECherrypreHis<) D_025 dna manual mimi prep 07/07/09
rg27-a08 rg1129 (>ZipRCitrinepreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-b08 rg1129 (>ZipRCitrinepreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-b09 rg1129 (>ZipRCitrinepreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg28-22a rg1129 (>ZipRCitrinepreHis<) C_028 cells
rg28-22b rg1129 (>ZipRCitrinepreHis<) C_028 cells
rg22-e08 rg1129 (>ZipRCitrinepreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-e09 rg1129 (>ZipRCitrinepreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-f08 rg1129 (>ZipRCitrinepreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-f09 rg1129 (>ZipRCitrinepreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg25-21 rg1129 (>ZipRCitrinepreHis<) D_025 dna manual mimi prep 07/07/09
rg27-c01 rg1133 (>Lov2CitrinepreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-d01 rg1133 (>Lov2CitrinepreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg28-23a rg1133 (>Lov2CitrinepreHis<) C_028 cells
rg28-23b rg1133 (>Lov2CitrinepreHis<) C_028 cells
rg22-g01 rg1133 (>Lov2CitrinepreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-h01 rg1133 (>Lov2CitrinepreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg25-22 rg1133 (>Lov2CitrinepreHis<) D_025 dna manual mimi prep 07/07/09
rg27-c03 rg1134 (>Lov2CerulpreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-d03 rg1134 (>Lov2CerulpreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg28-24a rg1134 (>Lov2CerulpreHis<) C_028 cells
rg28-24b rg1134 (>Lov2CerulpreHis<) C_028 cells
rg22-g03 rg1134 (>Lov2CerulpreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-h03 rg1134 (>Lov2CerulpreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg25-23 rg1134 (>Lov2CerulpreHis<) D_025 dna manual mimi prep 07/07/09
rg27-c04 rg1136 (>GLucBLov2preHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-d04 rg1136 (>GLucBLov2preHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg22-g04 rg1136 (>GLucBLov2preHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-h04 rg1136 (>GLucBLov2preHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg27-a02 rg1140 (>FrbCerulPreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-b02 rg1140 (>FrbCerulPreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg22-e02 rg1140 (>FrbCerulPreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-f02 rg1140 (>FrbCerulPreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg25-19 rg1140 (>FrbCerulPreHis<) D_025 dna Sample mixup: actually contains rg114...
rg27-a03 rg1141 (>FrbLactAPreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-b03 rg1141 (>FrbLactAPreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg22-e03 rg1141 (>FrbLactAPreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-f03 rg1141 (>FrbLactAPreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg27-c05 rg1142 (>CerulLov2PreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-d05 rg1142 (>CerulLov2PreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg28-25a rg1142 (>CerulLov2PreHis<) C_028 cells
rg28-25b rg1142 (>CerulLov2PreHis<) C_028 cells
rg22-g05 rg1142 (>CerulLov2PreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-h05 rg1142 (>CerulLov2PreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg25-24 rg1142 (>CerulLov2PreHis<) D_025 dna manual mimi prep 07/07/09
rg27-c06 rg1143 (Zip2LactBPreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-d06 rg1143 (Zip2LactBPreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg22-g06 rg1143 (Zip2LactBPreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg22-h06 rg1143 (Zip2LactBPreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg27-a01 rg1147 (>FrbCitrinePreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg27-b01 rg1147 (>FrbCitrinePreHis<) C_027 cells cell stock from 01/07/09 (100 µl o.n....
rg22-e01 rg1147 (>FrbCitrinePreHis<) D_022 dna robotic miniprep 01/07/09 cell stock...
rg22-f01 rg1147 (>FrbCitrinePreHis<) D_022 dna robotic miniprep 01/07/09 cell stock ...
rg25-18 rg1147 (>FrbCitrinePreHis<) D_025 dna manual mimi prep 07/07/09
rg10-65 None D_010 dna linear, digested, dephosphorylated ve...
rg10-1 None D_010 dna full plasmid miniprep 06/11/08 in H2O
rg10-25 None D_010 dna linear vector backbone from PCR with ...
rg10-47 None D_010 dna linear, digested vector backbone from...