Biobrick BBa_G00101 / BBa_G00101 (BBVR)

Specifications

  • Status:

    available

  • Experience:

    works

  • Type:

    G:primer

  • Size (bp):

    20

  • Users:

    tgraf marco admin raik

Actions

Description

VR: Reverse Primer to pSB* Biobrick Vectors

Originally named VR, This reverse primer binds downstream of the standard BBa_MSC on biobrick vectors. Used for general-purpose PCR and sequencing of Biobrick parts.

Usage:
  • Tm = 64 C

Sources & References

Source:

Source gene:

References

Sequence

Part Composition:

This Biobrick is a basic part and has no sub-parts.

Nucleotide sequence without Prefix and Suffix:
Biobrick scar sequences are capitalized

attaccgcctttgagtgagc

Amino acid sequence (simple in-frame translation)

ITAFE*

Fasta-style Nucleotide sequence for available Biobrick formats
Click to open view in new page. Views are generated for all formats this Biobrick is available in.
They start with the Prefix and end with the Suffix sequence.

Availability

This Biobrick can be found in the following Vectors and Samples:

Samplein VectorFormatContainer Storage CommentSequencing
rg05-17 None D_005 dna 06/02/09: empty 26/02/09: replaced b...