Biobrick rg0301 / BBa_J18910

Specifications

  • Status:

    available

  • Experience:

    none

  • Type:

    G:primer

  • Size (bp):

    23

  • Users:

    raik

Actions

Description

pSB*BBF linearizing Fw

forward primer for vector linearization of any vector containing the Freiburg Biobrick flanks, anneals to suffix covering AgeI and SpeI site

  • Tm (oligocalc nearest neighbore, 500nM primer, 50mM salt) = 60 C
  • Tm (finnzyme, 500nM primer, 50mM salt) = 65
  • Tm (biophp, 500mM, 50mM, 1.5mM MgCl2) = 67.5

See also: rg0302 for reverse

Sources & References

Source:

Source gene:

References

Sequence

Part Composition:

This Biobrick is a basic part and has no sub-parts.

Nucleotide sequence without Prefix and Suffix:
Biobrick scar sequences are capitalized

accggttaatactagtagcggcc

Amino acid sequence (simple in-frame translation)

TG*Y**R

Fasta-style Nucleotide sequence for available Biobrick formats
Click to open view in new page. Views are generated for all formats this Biobrick is available in.
They start with the Prefix and end with the Suffix sequence.

Availability

This Biobrick can be found in the following Vectors and Samples:

Samplein VectorFormatContainer Storage CommentSequencing
22/09/08-7 None D_009 dna in TE